Review



forward reverse primers  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs forward reverse primers
    Forward Reverse Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 12063 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/Q5+High-Fidelity+DNA+Polymerase/10__3390_slash_microorganisms14030516-69-29-44
    Average 99 stars, based on 12063 article reviews
    forward reverse primers - by Bioz Stars, 2026-09
    99/100 stars

    Images



    Similar Products

    86
    Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
    Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-52-0-5
    Average 86 stars, based on 1 article reviews
    epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag
    Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-50-0-5
    Average 86 stars, based on 1 article reviews
    dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag
    Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-53-0-5
    Average 86 stars, based on 1 article reviews
    wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg
    Tiparp Primers Forward Tgtttg Gccgtgacaggata Reverse Gcatgctttccacagcatcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc13145899-51-0-6
    Average 86 stars, based on 1 article reviews
    tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg
    Actb Primers Forward Actcttccagccttccttcc Reverse Tctccttctgcatcctgtcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/actin+%CE%B2/pmc13145899-54-0-5
    Average 86 stars, based on 1 article reviews
    actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech cdkn1b primers forward cttcttcgtcagcctcccttcc reverse gagtcgcagagccgtgagc
    Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
    Cdkn1b Primers Forward Cttcttcgtcagcctcccttcc Reverse Gagtcgcagagccgtgagc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/cdkn1c/pmc13145899-49-0-5
    Average 86 stars, based on 1 article reviews
    cdkn1b primers forward cttcttcgtcagcctcccttcc reverse gagtcgcagagccgtgagc - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    New England Biolabs forward reverse primers
    Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
    Forward Reverse Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/Q5+High-Fidelity+DNA+Polymerase/10__3390_slash_microorganisms14030516-69-29-44
    Average 99 stars, based on 1 article reviews
    forward reverse primers - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    94
    ATCC virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus
    Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
    Virus Forward Primer Reverse Primer Length Bp Rice Dwarf Virus Cgatcccgggaat Tcgga Ccgaattcccggg Atcc 525 Rice Stripe Virus, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/rice+dwarf+virus/10__1094_slash_pdis___06___25___1330___re-280-29-42
    Average 94 stars, based on 1 article reviews
    virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    86
    Sangon Biotech forward reverse primers
    Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and <t>CDKN1B</t> proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.
    Forward Reverse Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer+forward+and+reverse/primers/pm41540481-154-16-18
    Average 86 stars, based on 1 article reviews
    forward reverse primers - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and CDKN1B proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.

    Journal: iScience

    Article Title: Integrated study reveals molecular mechanisms by which bisphenol A promotes ovarian cancer

    doi: 10.1016/j.isci.2026.115768

    Figure Lengend Snippet: Molecular docking, molecular dynamics simulation, and validation (A) Vina score of molecular docking and BPA binding. The smaller the value, the higher the affinity for binding. (B) Molecular docking diagrams of interactions between BPA and CDKN1B proteins. (C) Molecular dynamics simulation of the BPA-CDKN1B complex. (D) Lysate-based CETSA analyzed the thermal stabilization of CDKN1B with BPA in SKOV3 cell lysates. Two-way ANOVA with post hoc analysis. The experimental data are presented as the mean ± standard error of mean (SEM). ( n = 3, n represents the number of biological replicates) ∗ p < 0.05. RMSD, root-mean-square deviation; Rg, radius of gyration; SASA, solvent accessible surface area; RMSF, Root-mean-square fluctuation.

    Article Snippet: CDKN1B primers Forward:CTTCTTCGTCAGCCTCCCTTCC Reverse:GAGTCGCAGAGCCGTGAGC , Sangon Biotech , N/A.

    Techniques: Biomarker Discovery, Binding Assay, Solvent